College of Health Sciences (CHS)
Permanent URI for this community
Browse
Browsing College of Health Sciences (CHS) by Author "Achom, Karen Bino"
Now showing
1
–
1
of 1
Results Per Page
Sort Options
-
ItemExpression and purification of an in-house Phusion DNA Polymerase using Escherichia coli BL21 (DE3) cells(Makerere University, 2022) Achom, Karen BinoIntroduction: DNA polymerases are enzymes that play a major role in enabling scientists to replicate DNA from organisms for a variety of studies in Molecular Biology. For years these polymerases have been isolated from a number of micro-organisms in the environment. Among these is a high fidelity Phusion DNA polymerase which is used in gene cloning. This study is aimed at expressing and purifying Phusion DNA Polymerase in-house from Escherichia coli BL2 (DE3) strains. Materials and methods: Some of the materials used in the study included Mycobacterium tuberculosis samples obtained from the archived MTB isolates from the Genomics Molecular and Immunology laboratory. Escherichia coli BL21 (DE3) pLysS phusion cells from CEND of University of California, San Francisco. Forward primer KatG5F with a sequence AACGACGTGGAAACAGCGGC and reverse primer KatGR with a sequence GCGAACTCGTCGGCCAATTC and Q5 DNA polymerase as the control. Escherichia coli BL21 (DE3) cells were cultures on an LB and kanamycin (at a final concentration of 50 µg/mL) and chloramphenicol (at a final concentration of 34 µg/mL) plate. A single isolated colony from the plate was picked and transferred into 25 mL of LB broth and kanamycin (50 µg/mL). Each 500 mL 2xYT media and kanamycin and chloramphenicol with 1.25 mL of the culture was inoculated, and allowed to reach an OD 600 of 0.6. To aid overexpression 500ul IPTG (Isopropyl ß-D1thiogalactopyranoside) was added for 6 hours. The protein was purified using cation exchange chromatography and this was followed by dialysis using a snake’s skin. A 12% SDS PAGE was run to verify presence of the polymerase and gel electrophoresis for the PCR amplicons of UGT1A1 gene and Catalase peroxidase (kat G) genes were run. Results: Over expression of Phusion polymerase in Escherichia coli BL21 (DE3) strains took six hours using IPTG to obtain an OD 600 of 0.4 and a 90kDa band was seen on the 12% SDS PAGE gel after dialysis. The gel electrophoresis of PCR amplicons of UGT1A1 and of kat G using purified Phusion DNA polymerase showed 243bp band and 455bp band respectively. Conclusion: Our findings contribute to more detailed information and will facilitate further research studies carried out on expression and purification of Phusion polymerases and other DNA polymerases.