Primer design and optimization for amplification of the RV1337 gene of H37RV strain in Mycobacterium tuberculosis

Abstract

Introduction: Tuberculosis (TB) remains a major worldwide health concern. In 2022, an estimated 10.6 million people, including 5.8 million men, 3.5 million women, and 1.3 million children worldwide fell ill with TB according to WHO. There has been a growing problem of drug resistant TB strains of H37RV, leading to Multidrug-resistant TB, hampering the treatment of first-line and second-line drugs. The Rv1337 gene contributes to multi drug resistance in MTB. This study would aid in designing and optimizing primer sets that can be used in PCR assays to amplify the Rv1337 gene, for the study of multi-drug resistance in H37RV TB strain and as well act as a new treatment target. Objective: This study was aimed at designing and optimizing primers for the Rv1337 gene amplification of H37RV strain in MTB at the Genomics, Molecular Biology and Immunology laboratory at College of Health Sciences, Makerere University. Methods: The MTB DNA was extracted using Modified CTAB, quantified using Nanodrop spectrophotometer 2000 (Thermo scientific) and then stored. The SnapGene software was used to design primers. The PYUBDUET plasmid sequence was copied from the Addgene website. The Rv1337 gene sequence was copied from KEGG website, created the forward and reverse primers. The designed primers were ordered and purchased from Macrogen Co. Europe. Then optimized using Gradient PCR, visualized under 1.2% agarose gel electrophoresis (Thermos Fisher) obtained the right annealing temperature of 68℃. Then we ran a conventional PCR (SimpliAmp thermocycler), finally visualized the PCR amplicons using agarose gel electrophoresis and obtained a band amplification of 723bp. Results: The forward and reverse primers were 5`AAGGGCAACTATGGGCATGA 3` and 3` AATTCATAACTTCGATGCCCGGA 5, respectively.